Pretreatment TACC3 expression in locally advanced rectal cancer decreases the response to neoadjuvant chemoradiotherapy

General characteristics

From May 1, 2003 to May 1, 2016, 152 patients who received neoadjuvant CRT for pathologically confirmed rectal cancer were selected from the Sun Yat-sen University Cancer Center Database. Clinical staging of eligible patients was based on pelvic MRI, ultrasound colonoscopy (with biopsy), CT of the thorax and abdomen, and clinical examination. All examinations were repeated 4 to 5 weeks after CRT for re-staging. Cancer biopsy specimens from 120 patients exhibited TACC3 expression, while those from the remaining 32 were negative for TACC3 expression (Table 1 and Figure 1A). Immunohistochemical and Western blot analyses revealed TACC3 was rarely expressed in normal tissue (Figure 1B). No significant difference in the clinical or pathologic characteristics was detected between the TACC3-positive and TACC3-negative patients, except for the distribution of tumor regression grading (TRG) (P = 0.001). Among all patients, 73 were defined as CRT responders, while 79 were defined as CRT non-responders. Forty-one patients achieved a pathological complete response (pCR, 27%). Figure 2 presents representative MR and colonoscopic ultrasound imaging as well as surgical specimens from one patient who achieved a pCR after CRT. Perineural invasion (PNI) (P = 0.014) and TACC3 expression (P = 0.001) significantly differed between patients who responded to CRT and those who did not. Further details are presented in Table 2.

Association between TACC3 expression and tumor response to CRT

In the logistic regression analysis, there was a significant association between pCR and negative TACC3 expression [risk ratio (RR) = 3.252, 95% confidence interval (CI): 1.918–5.512; P = 0.001]. When the response to CRT was analyzed, TACC3 expression [risk ratio (RR) = 2.236, 95% confidence interval (CI): 1.447–3.456; P = 0.001] and adjuvant chemotherapy cycles (RR = 0.558, 95% CI: 0.395–0.874; P = 0.009) also showed significant association.

Relationship between TACC3 expression and clinicopathological variables

Analysis of the correlation between TACC3 expression and the clinical and pathological variables revealed no significant correlations between TACC3 expression and clinical T stage (P = 0.586), N stage (P = 0.059), PNI (P = 0.430), the presence of tumor deposits (TDs) (P = 0.559), lymphovascular invasion (LVI) (P = 0.062), pathological type (P = 0.692), carcinoembryonic antigen (CEA) level (P = 0.846), CA19-9 level (P = 0.629), sex (P = 0.983), or age (P = 0.792). On the other hand, TACC3 correlated strongly with TRG (P = 0.001).

TACC3 knockdown in HCT116 and SW480 cells and the response to radiotherapy

To investigate the potential role of TACC3 in determining the sensitivity colorectal cancer (CRC) to radiotherapy, we measured cell proliferation, colony formation and apoptosis after knocking down TACC3 expression using specific siRNA. As shown in Figure 3, transfection of siRNA targeting TACC3 significantly decreased the protein expression of TACC3 in HCT116 and SW480 cells (Figure 3A). TACC3 knockdown significantly increased the inhibitory effect of radiotherapy (Radio-2Gy) on HCT116 and SW480 cell proliferation (Figure 3B and Figure 3C) and on colony formation by the two cell lines (Figure 3D and 3E). TACC3 knockdown also enhanced the apoptotic effect of radiotherapy (Radio-2Gy) on HCT116 (Figure 3F). These results suggest that TACC3 plays a crucial role in mediating radiotherapy resistance and that inhibition of TACC3 could increase the sensitivity of CRC to radiotherapy.

Correlation between TACC3 expression and overall and disease-free survival

All 152 patients were followed-up until November 1, 2017 and were included in the survival analysis. The median follow-up period was 41 months. At the end of the follow-up period, 117 patients were alive, and 35 had died. Univariate analysis to determine possible variables that could affect overall and disease-free survival among rectal cancer patients showed that the CEA level (RR = 1.002, 95%CI: 1.012- 3.831, P = 0.049), the presence of TDs (RR = 4.014, 95%CI: 1.712-9.411, P = 0.001), and the number of neoadjuvant chemotherapy cycles (RR = 0.828, 95%CI: 0.709-0.967, P = 0.022) were strongly related to overall survival. In addition, TACC3 expression (RR = 2.671, 95%CI:1.050-6.793, P = 0.032), the CA19-9 level (RR = 1.001,95%CI: 0.998 – 1.003, P = 0.021), the presence of TDs (RR = 2.856, 95%CI: 1.242- 6.565, P = 0.01), and tumor differentiation (RR = 3.147, 95%CI:0.000-5.814, P = 0.044) were strongly related to disease-free survival. Other variables showed no relationship with the survival of rectal cancer patients (additional details are given in Figure 4, the Supplementary Figure S1 and Table 3).

A Cox multivariate analysis revealed that the significant prognostic factors for overall survival were TACC3 expression (RR = 3.714, 95% CI = 1.261–10.93; P = 0.017) and the presence of TDs (RR = 3.084, 95% CI = 1.323–7.190; P = 0.017). The CEA level (RR = 1.008, 95% CI = 1.001–1.015; P = 0.028), TACC3 expression (RR = 3.140, 95% CI: 1.201–8.210; P = 0.020), and the presence of TDs (RR = 2.727, 95% CI = 1.183–6.286; P = 0.019) were significant prognostic factors for disease-free survival. Additional details are presented in Table 3.

At the end of the 5-year follow-up period, the overall survival rate for all enrolled patients was 60%, and the disease-free survival rate was 51%. The 5-year overall survival rate was 77% for patients whose tumors were TACC3-negative and 54% for those whose tumors were TACC3-positive (P = 0.072, Figure 4A). The 5-year disease-free survival rate was 74% for TACC3-negative patients and 43% for TACC3-positive patients (P = 0.032, Figure 4E).

Patients and treatment

From May 28, 2003 to May 31, 2016, all rectal cancer patients who received neoadjuvant CRT were screened from the Sun Yat-sen University Cancer Center Database. The inclusion criteria were: histologically confirmed rectal cancer; no detected distant metastasis; T3 or T4b diagnosed by MRI, ultrasound or colonoscopy, with or without positive regional lymph nodes; no severe primary tumor-related symptoms (severe bleeding, bowel obstruction or perforation); resectable primary tumor; Eastern Cooperative Oncology Group performance status of 0 or 1; age between 18 and 75 years; and written informed consent. The exclusion criteria were: high rectal cancer (tumor >10 cm from the anal verge; tumor-related symptoms (bleeding requiring transfusion, bowel obstruction, or tumor perforation); patients not eligible for surgery or CRT; distant metastasis; history of another primary cancer (not including skin or cervical cancer); inability to complete standard neoadjuvant CRT; death within one month after surgery; did not undergo radical surgical resection; or lost to follow-up within 6 months. Prior to neoadjuvant treatment, tumor tissue collected during colonoscopy was deposited in the tissue bank at Sun Yat-sen University Cancer Center. Adjuvant chemotherapy was recommended for all patients, including those who achieved pCR.

All patients received standard radiotherapy. A total dose of 50 Gy was delivered to the gross tumor volume, and 46 Gy were delivered to the clinical target volume. High-energy photons (6 or 8 MV) were delivered in 25 daily fractions, from Monday to Friday, over a period of 5 weeks. Chemotherapy was recommended to all patients receiving radiotherapy.

The neoadjuvant chemotherapy regimens consisted of capecitabine, CapOX (capecitabine and oxaliplatin), FOLFOX, and 5-fluorouracil (5-FU). Surgical resection entailed anterior resection, abdominal perineal resection, or the Hartmann procedure. Both open surgery and laparoscopic surgery were acceptable.

This study used the AJCC TRG system to evaluate patient response to CRT. Tumor regression was classified into four histologic TRGs based on vital tumor tissue and the ratio of fibrosis after CRT: TRG 0, complete regression and the absence of viable cancer cells; TRG 1, the presence of only small clusters or single cancer cells; TRG 2, the presence of residual cancer cells with predominant fibrosis; and TRG 3, minimal or no decrease in the tumor cells or extensive residual cancer (Figure 5). Patients classified as TRG 0 or 1 were considered chemotherapy responders, while those classified as TRG 2 or 3 were chemotherapy non-responders.

Follow-up

All patients were followed-up in accordance with NCCN guidelines. During the first two years, all patients were followed-up at every 3 months. Thereafter, patients were followed-up every 6 months for the next 3 years and annually after 5 years. During each visit, the patients underwent a physical examination, testing for CEA and CA19-9 levels, and abdominal and pelvic ultrasound examinations. Colonoscopy after resection was recommended at approximately one year, or at 3 months if it was not performed preoperatively due to the presence of an obstructing lesion. A repeat colonoscopy was typically recommended at 3 years and every 5 years thereafter, unless follow-up colonoscopy indicated the presence of an advanced adenoma in which case the colonoscopy was repeated in one year. All patients underwent chest, abdominal, and pelvic CT scans annually until 5 years after surgery.

Immunohistochemical analysis

Immunohistochemistry was performed as previously reported [24]. Paraffin-embedded specimens were serially cut into three 4-μm-thick sections. One section was used for routine hematoxylin and eosin staining, while the other two sections were used for staining using the streptavidin peroxidase (SP) immunohistochemistry method. The experimental procedure was performed according to the manufacturer’s instructions for each reagent kit. After the specimens were deparaffinized and rehydrated, they were washed three times in PBS and boiled in a high-pressure cooker for 2.5 min in EDTA buffer (pH 8.0) for antigen retrieval. Non-specific binding was then blocked using 5% BSA, after which the sections were incubated consecutively with the primary antibody, secondary antibody, and enzyme-labeled SP. Finally, the sections were developed using 3,3’-diaminobenzidine (DAB) and counterstained with hematoxylin. The stained sections were cleared, mounted, and examined under a microscope.

The primary antibody solution consisted of a rabbit anti-human TACC3 monoclonal antibody (1:400 dilution; ab134154, Abcam) in blocking buffer, which was incubated with the sections at 4°C overnight in a moist chamber. Blocking buffer without the primary antibody was used as a negative control.

Each slide was evaluated using the immunohistochemistry scoring system used in our previous study [41]. If the conclusions of the two pathologists differed, a third pathologist evaluated each case independently and decided the final score. Based on the staining intensity, the results were classified as negative, weak, moderate, or strong. Negative was defined as no TACC3 expression, while weak, moderate and strong encompassed positive TACC3 expression.

Western blotting

Western blotting was conducted as previously described [24]. Briefly, equal amounts of protein were separated by 8% SDS-PAGE. The resolved proteins were electrophoretically transferred onto 0.22-μm PVDF membranes, after which the membranes were incubated with rabbit anti-human TACC3 (1:1000; Sigma), anti-β-actin (1:1000; CST) and anti-GAPDH (1:3000; Thermo Fisher Scientific Inc) antibodies.

Quantitative real-time RT PCR

Total RNA was isolated from tissues using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was obtained by reverse transcription using the M-MLV Kit (Promega, Madison, WI, USA) for RT-qPCR. SYBR Green (Bio-Rad) was used for RT-PCR gene expression analysis, carried out on Bio-Rad CFXplatform. Relative mRNA levels were normalized to GAPDH mRNA. The primer sequences are listed below.

TACC3:

S: CCTCTTCAAGCGTTTTGAGAAAC,

AS: GCCCTCCTGGGTGATCCTT;

GAPDH:

S: GAAGGTGAAGGTCGGAGTC,

AS: GAAGATGGTGATGGGATTTC.

Transfection of siRNAs

Cells in 6-well plates were transfected with 100 nM specific or nontarget control siRNA using Lipofectamine 2000 according to the manufacturer’s protocol. The transfected cells were incubated for 24 h at 37°C in FBS-free medium. The target sequences of the TACC3 siRNAs were CCACAGATCTGAACTCCAT for siTACC3-1 (si1) and GGATTACCTGGAGCAGTTT for siTACC3-2 (si2). The efficiency of siRNA interference was assessed by immunoblotting using an anti-TACC3 antibody.

Colony formation assay

Cells were seeded into 6-well plates (500-1000 cells per well) and cultured for 7-14 days. After fixation in methanol for 10 min, the colonies formed were stained with 0.5% crystal violet in 20% methanol and counted. All the experiments were performed independently in triplicate.

CCK-8

Suspension of transfected cells was dispensed into 96-well plates (1,000 cells/well, 100 μL) and then incubated for 1 to 7 days (humidified atmosphere, 37°C, 5% CO2). Thereafter, 10 μL of CCK8 (Dojindo Laboratories, Kumamoto, Japan) was added to each well, and the cells were incubated for an additional 4 h at 37°C. The absorbance at 460 nm (A460) was then assayed using a scanning multiwell spectrophotometer (Thermo Scientific).

Apoptosis assay

An Annexin V/PI apoptosis kit was used to assess the incidence of apoptotic cell death. Cells incubated for 24 h in 6-well plates (5 x 10⁴ cells/well) were exposed to radiation and then incubated for an additional 24 h. Approximately 1 x 10⁵ cells were stained for 5 min with Annexin V/PI in the dark and then analyzed using a two-color flow cytometric assay. The Annexin V/PI apoptosis kit detects the externalization of phosphatidylserine in apoptotic cells using recombinant FITC-conjugated annexin V (green) and dead cells using red-fluorescent propidium iodide (PI; red). After treatment with the two probes, early stage apoptotic cells fluoresced green, while late stage apoptotic cells red fluoresced red and green. Live cells showed little or no fluorescence [42]. The data were analyzed using the Cell Quest program (Beckman Coulter).

Statistical analysis

The clinical and follow-up data were analyzed using SPSS v19.0. The χ², continuity correction χ², and Fisher’s exact tests were used to assess the patients’ baseline variables. The significance of the variables was tested using multivariate Cox regression and logistic regression models. Overall survival was defined as the interval between surgical resection and death or the end of follow-up. Disease-free survival was defined as the interval between surgical resection and recurrence, metastasis, or the end of follow-up. Values of P < 0.05 were considered significant.

Ethics approval and consent to participate

This study was approved by the Institutional Research Ethics Committee of Sun Yat-sen University Cancer Center. Informed consent to use tissue samples collected before the initial treatment were obtained from all patients.

Availability of data and materials

The datasets analyzed during the current study were available from the corresponding author on reasonable request. Anyone who is interested in the information should contact zhangrx@sysucc.org.cn or zhouzhg@sysucc.org.cn.