Correction Volume 15, Issue 8 pp 3218
Correction for: Comprehensive analysis of prognostic value, relationship to cell cycle, immune infiltration and m6A modification of ZSCAN20 in hepatocellular carcinoma
- 1 Second Affiliated Hospital of Nanchang University, Nanchang, China
- 2 Second College of Clinical Medicine, Nanchang University, Nanchang, China
- 3 Department of Thyroid Surgery, Second Affiliated Hospital of Nanchang University, Nanchang, China
- 4 Department of Urology, Second Affiliated Hospital of Nanchang University, Nanchang, China
Received: April 26, 2023 Accepted: April 28, 2023 Published: April 29, 2023
https://doi.org/10.18632/aging.204699How to Cite
Copyright: © 2023 Jiayu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
This article has been corrected: The authors updated the text of the Quantitative real-time PCR section with the sequences of the real-time PCR primers.
Corrected Materials and methods section is presented below.
Quantitative real-time PCR
Real-time PCR was performed on fresh frozen samples. Total RNA was isolated from tissues using the TRIzol reagent (Thermo Fisher Scientific). Then, according to standard methods, qRTPCR analysis was performed to observe the expression level of ZSCAN20. Primers for ZSCAN20 from 5’ to 3’: TGGCCTGGTCAATGTTGAGT (F), TGCACACCTGCAATACGACT (R). Primers for β-actin from 5’ to 3’: TGGAACGGTGAAGGTGACAG (F), AACAACGCATCTCATATTTGGAA (R).
