Modulation of the glyoxalase system in the aging model Podospora anserina: effects on growth and lifespan

Identification of PaGlo1 and PaGlo2 in the genomic sequence of P. anserina

The published amino acid sequences of Saccharomyces cerevisiae GLO1 (UniProt accession number P50107) and GLO2 (UniProt accession number Q05584) were used to search the genomic sequence of P. anserina [21] for the corresponding homologs via the BlastX (protein sequence vs. nucleotide sequence) algorithm [22]. For each protein, one homolog, designated PaGLO1 and PaGLO2, respectively, was identified. The sequence homology of PaGLO1 and PaGLO2 to their S. cerevisiae counterparts is strongly conserved, displaying 42% and 48% sequence identity, respectively (Figure 1). In the PaGLO1 sequence, a signature glyoxalase I motif was identified (amino acid positions 165-186) by an in silico analysis using Expasy Prosite. It is located in the central region of the protein and contains a conserved histidine residue which is implicated to bind the zinc cofactor in human GLO1 [23] (Figure 1).

Figure 1. Homology analysis between P. anserina and yeast proteins of the glyoxalase system. A Comparison of the amino acid sequences of glyoxalase I proteins from P. anserina (PaGLO1, UniProt accession number B2AQW8) and S. cerevisiae (ScGLO1, UniProt accession number P50107). Signature glyoxalase I sequences are indicated with gray boxes and were identified by utilizing the Prosite database. B Comparison of the amino acid sequences of glyoxalase I proteins from P. anserina (PaGLO2, UniProt accession number B2B554) and S. cerevisiae (ScGLO2, UniProt accession number Q05584). After the yeast sequences the amino acid identity relative to the P. anserina proteins is shown. Non-homologous and homologous amino acids are indicated in red and green colour, respectively.

The available genome sequence of P. anserinais derived from wild type strain ‘S’. Since all experiments in the current study were performed with a different wild type strain, ‘s’, the two genes from this strain were sequenced and the gene sequences were compared with the published sequences. No differences within the genes between the two strains were identified. The accession numbers assigned by UniProt are B2AQW8 (PaGLO1) and B2B554 (PaGLO2), respectively.

Generation and verification of transgenic PaGlo1 and PaGlo2 P. anserina strains

After the identification of PaGlo1 and PaGlo2 we set out to characterize the glyoxalase system of P. anserina by creating and analyzing various transgenic glyoxalase strains (i. e., single PaGlo1 overexpression, single PaGlo2 overexpression, double PaGlo1/PaGlo2 overexpression and PaGlo1 deletion). Plasmids for modulation of the glyoxalase system in P. anserina were constructed, verified and transformed into wild type protoplasts. Three independent putative overexpression transformants for PaGlo1 and PaGlo2, respectively , were selected on hygromycin B-containing medium. Transformants in which PaGlo1 is deleted were selected by growth on phleomycin-supplemented medium. PaGlo1/PaGlo2_OEx double mutants were generated by crossing the single overexpression mutants and selection of progeny in which recombination resulted in the combination of the PaGlo1 and PaGlo2 overexpression cassettes in one nucleus. The complete integration of the PaGlo1 or PaGlo2 expression cassettes into the genome and the deletion of PaGlo1 were verified via Southern-blot analyses (data not shown). Subsequently, Western-blot analyses were performed using newly generated specific polyclonal peptide antibodies against PaGLO1 and PaGLO2, respectively (Figure 2). All PaGlo1_OEx and PaGlo2_OEx transformants were found to contain significantly elevated levels of PaGLO1 and PaGLO2, respectively (Figure 2 A). As expected, the PaGLO1 protein is not detectable in the ΔPaGlo1 strain (Figure 2 A). However, in some transformants (e.g., PaGlo2_OEx strains) a further signal is visible, slightly above PaGLO1. This additional band is possibly due to unspecific cross-reaction of the polyclonal PaGLO1 antibody. The successful selection of PaGlo1/PaGlo2_

OEx double mutants was verified by the demonstration of strongly elevated levels of both PaGLO1 and PaGLO2 in the corresponding strains (Figure 2 B).

Figure 2. Immunodetection analysis of PaGLO1 and PaGLO2 levels in the wild type (WT) and transgenic glyoxalase strains. A. Total protein extracts isolated from WT, single PaGlo1- and PaGlo2- overexpression mutants (three independent isolates from each PaGlo1_OEx and PaGlo2_OEx, respectively) and the deletion strain ΔPaGlo1 were analyzed using antibodies against PaGLO1 and PaGLO2 after transfer to a PVDF membrane. BTotal protein extracts isolated from WT and double PaGlo1/PaGlo2 overexpression mutants (three independent isolates) were similarly analyzed. Detection of the cytosolic protein PaPRE3 (β1-subunit of the 20S proteasome) and protein staining of the transfer membrane with Coomassie were performed as loading controls. Accession numbers: PaGLO1: B2AQW8 (UniProt); PaGLO2: B2B554 (UniProt); PaPRE3: Pa_5_4560 (Podospora anserinasequencing consortium).

Growth tests on media supplemented with additional glucose and MG

Next we tested whether altered expression of genes encoding components of the glyoxalase system has an effect on growth rate under different conditions. It is known that elevated levels of glucose lead to the formation of increased MG levels [24]. Therefore we first investigated growth of the transformants on medium supplemented with elevated levels of glucose (2% instead of 1%). No changes of the mean growth rate were found when the different genetically modified strains were grown on synthetic medium (PASM) with 2% glucose compared to the wild type (Table 1). It is important to note that these types of experiments need to be performed simultaneously by growing the strains to be compared in one set of experiment. This is crucial because even small changes in conditions (e.g., media composition) can lead to differences in reads-outs.

In a second set of experiments, we challenged the different strains with elevated levels of MG. Growth rate determinations were performed on PASM containing 1% glucose and increasing concentrations of MG (i. e., 40 μM, 80 μM, 400 μM). While all strains were found to grow only very weakly on medium supplemented with 400 μM MG, the addition of low doses of MG (40 μM) had no effect on the growth rate of the wild type and the overexpression mutants PaGlo2_OEx and PaGlo1/PaGlo2_OEx. Under these conditions, MG seems not to lead to high molecular damage and affects mycelial growth. In contrast, PaGlo1_OEx mutants are characterized by an increased growth rate compared to the wild type (+ 7.7%). Moreover, the ΔPaGlo1 strain is unable to grow at all on PASM 1% glucose + 40 μM MG demonstrating an essential role of PaGLO1 to detoxify MG. The same tendency is observed when higher MG doses (80 μM) are applied, but on this medium PaGlo1_OEx strains do not show an elevated mean growth rate (Table 1).

Taken together, two of the transgenic strains generated in this study show a different growth rate than the wild type under certain conditions. Demonstrating the need for PaGLO1 in the efficient detoxification of MG, ΔPaGlo1 fails to grow on MG-supplemented medium. The PaGlo1_OEx mutant is characterized by an increased mean growth rate when cultivated on PASM 1% glucose + 40 μM MG.

Determination of median lifespan

To analyze whether or not the modification in the abundance of enzymes of the glyoxalase system affects aging, we compared the lifespan of the newly generated transgenic strains to those of the wild type. Meiotic offspring resulting from crosses between transformants and the wild type were isolated. The identity of strains was verified by growth selection on hygromycin B (overexpression strains) or phleomycin (ΔPaGlo1 mutant) containing medium. Subsequently, survival curves were recorded by measuring the lifespan of the isolates in race tubes with synthetic medium containing either 1% glucose or 2% glucose (Table 2).

On PASM containing 1% glucose no significant differences in median lifespan of the glyoxalase mutants were found compared to the wild type (Table 2). In marked contrast, on PASM containing 2% glucose PaGlo1_OEx, PaGlo1/PaGlo2_OEx and ΔPaGlo1 strains are characterized by clear differences in lifespan (Figure 3, Table 2). In comparison to the wild type, PaGlo1_OEx and ΔPaGlo1 strains are characterized by a significant reduction in lifespan of 14.7% and 22.2%, respectively (Figure 3 A, C). In contrast, PaGlo1/PaGlo2_OEx shows a moderate (+ 4.3%) but statistically significant increased median lifespan (Figure 3 B). Notably, the double mutant has a ‘healthy’ phenotype with no impairments in mycelial growth, pigmentation or the formation of aerial hyphae (Figure 4).

Collectively, the results of this series of experiments demonstrate that the lifespan of specific P. anserina glyoxalase mutants (i.e., PaGlo1_OEx, PaGlo1/PaGlo2_OEx and ΔPaGlo1) is influenced on medium containing elevated amounts of glucose.

P. anserina strains and cultivation.

Overexpression strains PaGlo1_OEx, PaGlo2_OEx, PaGlo1/ PaGlo2_OEx and the PaGlo1 deletion strain ΔPaGlo1 are derived from wild type strain ‘s’ [38]. If not noted otherwise, the P. anserina isolates used in this study were grown on synthetic medium (PASM 1% glucose or PASM 2% glucose, respectively) in an incubation chamber at 27 °C. Composition of PASM (per litre): 0.5 g KH₂PO₄, 0.6 g K₂HPO₄, 1 g urea, 2.5 μg biotin, 50 mg thiamine, 5 mg citric acid x H₂O, 5 mg ZnSO4 x 7 H₂O, 1 mg Fe(NH₄)₂(SO₄)₂ x 6 H₂O, 0.25 mg CuSO₄ x 5 H₂O, 0.05 mg MnSO₄x H₂O, 0.05 mg H₃BO₃, 0.05 mg Na₂MoO₄ x 2 H₂O. For the determination of resistance againstmethylglyoxal (MG), MG concentrations of 40 μM and 80 μM were used in PASM 1% glucose. MG stock solution (40% in H₂O) was purchased from Sigma Aldrich, St Louis, MO.

P. anserina lifespan and growth rate analysis.

Ascospores from the wild type strain ‘s’ and the transgenic strains were isolated and germinated on cornmeal agar supplemented with 60 mM ammonium acetate. After three days of incubation, a small piece cut from the juvenile mycelium was placed into a race tube containing 50 ml PASM 1% glucose or PASM 2% glucose, respectively. Growth was measured until the isolate stopped to grow. Such cultures were defined as ‘dead’. The elapsed time to this point was recorded as the lifespan of the corresponding isolate. The median lifespan is defined as the time point when 50% of the analyzed cultures have died. Growth rates were determined by dividing the length of the mycelia by the time it took to grow. Individual differences in growth rate and lifespan of the WT controls observed in experiments conducted in independent experiments at different times are due to slight environmental variations. Therefore, in each individual experiment, freshly prepared wild type isolates were used as control.

Homology analyses.

Homology between related proteins was determined using the BLOSUM62 algorithm implemented in ‘Clone Manager Suite 6’ (Scientific and Educational Software, Cary, NC).

Constructs.

To overexpress PaGlo1in P. anserinawild type, the gene including the terminator region was amplified using primers XbaI-Glx1-f (5'- AATCTAGAATGGCGTCGACTACTGATG −3') and PstI-Glx1-r (5'- AACTGCAGTGTGACCCATCAGTT ATCC −3'). The PCR fragment was cloned after digestion into the XbaI/PstI site of vector pExMthph [39] containing a 0.56 kbp promoter fragment of the metallothionein gene, PaMt1 [40]. The resulting vector (termed pGlx1Ex) was transformed into wild type protoplasts. For overexpession of PaGlo2 in the genetic background of the wild type, the gene including the terminator region was amplified using primers BamHI-Glx2-f (5'-AAGGATCC ATGCATATCCGGTCTATT CC-3') and HindIII-Glx2-r (5'-AAAAGCTT AGCGAA CCATAAAATCCG-3'). The PCR fragment was cloned after digestion into the BamHI/HindIII site of vector pExMthph. The resulting plasmid (termed pGlx2Ex) was transformed into wild type protoplasts.

Deletion of PaGlo1 in wild type strain ‘s’ was performed according to a previously published method [41]. First, small flanking regions of the PaGlo1 gene were amplified using for the 5' flank oligonucleotides KoGlx1 (5'-TTGGTACC CAACTTGTCACTATCAGC −3') and KoGlx2 (5'-CCCAAGCTT AAATTCTCATT CATTAGC-3'), and KoGlx3 (5'-AAACTAGT GAAGGGCGGATATGCAGG-3') and KoGlx4 (5'- AAGCGGCCGCTACACATGGAAGGAGTGG-3') for amplification of the 3' flank. The 5' fragment was digested with KpnI and HindIII and ligated into plasmid pKO3. The resulting plasmid was named pGlx1Ko1. The 3' fragment was digested with BcuI and NotI and ligated into pGlx1Ko1. The resulting plasmid was termed pGlx1Ko2 and contains both fragments flanking a resistance cassette bearing phleomycin and blasticidin marker genes for fungal and bacterial selection, respectively. The resistance cassette with the flanking regions was excised by restriction with NotI and KpnI and used to transform E. coli strain KS272 bearing the plasmid pKOBEG [42], which contains the ‘red’ region of bacteriophage lambda, and the cosmid 3A7 [43] bearing the PaGlo1 locus. Homologous recombination between the flanks of the resistance cassette and cosmid 3A7 lead to generation of cosmid ΔGlx1#3A7, which contains the phleomycin-blasticidin cassette with large flanking genomic regions. The cosmid was isolated and used to transform P. anserina wild type strain ‘s’. Positive transformants (i.e., PaGlo1 deletion strains) were selected by growth on phleomycin containing medium. The cosmid also bears a hygromycin B resistance cassette, which is integrated upon its ectopic integration into the genome. Therefore, positive transformants must not be able to grow on medium supplemented with hygromycin B.

DNA sequencing.

DNA sequencing was performed by ‘Scientific Research and Development GmbH’, Oberursel, Germany.

P. anserina transformation.

The constructs used in this study were transformed into P. anserina protoplasts according to previously published protocols [44, 45]. 5*10⁷ protoplasts were used in each transformation.

Total protein extraction from P. anserina.

Total proteins were isolated by grinding approximately 3-4 g of wet mycelium in liquid nitrogen. The mycelial powder was dissolved in 1 mL extraction buffer (5 mM EDTA, 50 mM Na₂HPO₄, 1/100 Protease Inhibitor Cocktail [Calbiochem, Nottingham, UK], pH 7.5) and disrupted by vortexing cycles. The sample was centrifuged (25700 g, 10 min, Sorvall GSA SLA-7500 rotor) and the concentration of the supernatant was determined according to a modified protocol as described by Bradford using Roti-Nanoquant (Roth, Karlsruhe, Germany).

Generation of antibodies.

Antibodies directed against components of the P. anserina glyoxalase system were newly generated: α-PaGLO1 raised against a PaGLO1 specific synthetic peptide ([Ac]-CVQNERFADKANF-[OH]; New England Peptide, Gardner, MA) corresponding to amino acids 302-313 and α-PaGLO2 raised against a PaGLO2 specific synthetic peptide ([Ac]-CFTIGDEKQHNV-[amide]; New England Peptide, Gardner, MA) corresponding to amino acids 213-223.

SDS-PAGE and Western blot analysis.

100 μg of mitochondrial protein was incubated at 95 °C for 10 min in loading buffer (0.1 M Tris [pH 6.8], 6% SDS, 6% glycerol, 0.6 M ?-mercaptoethanol, 0.08% bromophenolblue) and was subsequently separated by using either 10 or 15% SDS-PAGE, respectively. After electrophoretic separation, proteins were transferred to a PVDF membrane (Immobilon-FL, Millipore, Schwalbach, Germany) using an electro-blotting system (Bio-Rad, Munich, Germany). Transfer membranes were incubated in blocking buffer (Li-Cor, Lincoln, NE, USA) for 1 h at RT and subsequently probed with the polyclonal P. anserina PaGLO1 antibodies (α-PaGLO1) (1:2000, overnight, 4 °C) or the polyclonal P. anserina PaGLO2 antibodies (α-PaGLO2) (1:2000, overnight, 4 °C). Labelling was detected with secondary antibodies (IRDye conjugated goat-α-rabbit [Li-Cor, Lincoln, NE, USA], 1:15000, 1 h, RT) and scanning the blots with an Odyssey infrared scanner (Li-Cor, Lincoln, NE, USA). As a loading control, transfer membranes were either treated with polyclonal P. anserina PaPRE3 antibodies directed against the β1-subunit of the 20S proteasome (1:2500, overnight, 4 °C) or stained with Coomassie Blue.

Statistical analysis.

Statistical analysis of the results was performed by applying the Wilcoxon test (two-tailed).