Correction Volume 15, Issue 6 pp 2358—2360
Correction for: Jian-Pi-Yi-Shen decoction inhibits mitochondria-dependent granulosa cell apoptosis in a rat model of POF
- 1 Department of Nephrology, The Fourth of Affiliated Hospital of Guangzhou University of Traditional Chinese Medicine (Shenzhen Traditional Chinese Medicine Hospital), Guangzhou University of Traditional Chinese Medicine, Shenzhen, China
- 2 Key Laboratory of Ministry of Education for Traditional Chinese Medicine Viscera-State Theory and Applications, Liaoning University of Traditional Chinese Medicine, Shenyang, China
- 3 College of Pharmacy, Liaoning University of Traditional Chinese Medicine, Dalian, China
- 4 Department of Internal Medicine, Liaoning Provincial Corps Hospital of Chinese People’s Armed Police Forces, Shenyang, China
- 5 Department of Endocrinology and Metabolism, The Fourth People’s Hospital of Shenyang, Shenyang, China
- 6 Department of Pharmacy, General Hospital of Northern Theater Command, Shenyang, China
- 7 NHC Key Laboratory of Male Reproduction and Genetics, Guangdong Provincial Reproductive Science Institute (Guangdong Provincial Fertility Hospital), Guangzhou, China
- 8 College of Basic Medical Science, Chinese Capital Medical University, Beijing, China
Received: December 5, 2022 Accepted: March 29, 2023 Published: March 30, 2023
https://doi.org/10.18632/aging.204637How to Cite
Copyright: © 2023 Jiang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
This article has been corrected: The authors corrected Table 3, “Sequence of primers for RT-PCR and long PCR,” because they forgot to update this table before submission. The primers used in the study were changed three times before a set that worked was synthesized and verified by “Sangon Biotech.” They also found and corrected a duplication in Figure 5B created during the figure assembly - column chart “PGC-1α” replicates column chart “Fis1.” Correction was done with data from the original sets of Western blots for PGC-1α protein. These corrections have no impact on the experimental outcome or conclusions.
The corrected Table 3 and Figure 5 are presented below.
Table 3. Sequences of primers for RT-PCR and long PCR. |
---|
Target Gene | Primer Sequence | Tm (°C) |
OPA1 | Forward: 5’-TGGTTCGAGAGTCGGTTGAA-3’ | 56 |
Reverse: 5’- CCTCCCAGTGCTTTGGAGTA -3’ | 56 | |
Mfn1 | Forward: 5’-GGGAAGACCAAATCGACAGA-3’ | 57 |
Reverse: 5’-CAAAACAGACAGGCGACAAA-3’ | 57 | |
Mfn2 | Forward: 5’-GAGAGGCGATTTGAGGAGTG-3’ | 58 |
Reverse: 5’-CTCTTCCCGCATTTCAAGAC-3’ | 56 | |
Drp1 | Forward: 5’-GCCCGTGGATGATAAAAGTG-3’ | 56 |
Reverse: 5’-TGGCGGTCAAGATGTCAATA-3’ | 56 | |
Fis1 | Forward: 5’-AGATGGACTGGTAGGCATGG-3’ | 56 |
Reverse: 5’-GACACAGCCAGTCCAATGAG-3’ | 56 | |
PGC-1α | Forward: 5’-GGACGAATACCGCAGAGAGT-3’ | 59 |
Reverse: 5’-CCATCATCCCGCAGATTTAC-3’ | 56 | |
Tfam | Forward: 5’-TCACCTCAAGGGAAATTGAAG-3’ | 55 |
Reverse: 5’-CCCAATCCCAATGACAACTC-3’ | 56 | |
Long Fragment | Forward:5’-AAAATCCCCGCAAACAATGACCACCC-3’ | 72 |
Reverse: 5’-GGCAATTAAGAGTGGGATGGAGCCAA-3’ | 72 | |
Short Fragment | Forward: 5’-CCTCCCATTCATTATCGCCGCCCTGC-3’ | 60 |
Reverse: 5’-GTCTGGGTCTCCTAGTAGGTCTGGGAA-3’ | 60 | |
Bax | Forward: 5’-GCGATGAACTGGACAACAAC-3’ | 57 |
Reverse: 5’-GATCAGCTCGGGCACTTTAG-3’ | 58 | |
Bcl-2 | Forward: 5’-CGAGTGGGATACTGGAGATGA-3’ | 58 |
Reverse: 5’- GACGGTAGCGACGAGAGAAG-3’ | 59 | |
Caspase-3 | Forward: 5’-GACTGGAAAGCCGAAACTCT-3’ | 55 |
Reverse: 5’-TGCCATATCATCGTCAGTTCC-3’ | 54 | |
Caspase-9 | Forward: 5’-CAGAGGTTCTCACACCAGAAA-3’ | 54 |
Reverse: 5’-TGCCATATCTGCATGTCTCTC-3’ | 54 | |
ASK1 | Forward: 5’-GACAAGAGAGCCTGTGCTAAT-3’ | 54 |
Reverse: 5’-TCTCCGTGCAACCACATAC-3’ | 55 | |
JNK | Forward: 5’-GGATTTGGAGGAGCGAACTAA -3’ | 54 |
Reverse: 5’-CATTGACAGACGGCGAAGA-3’ | 55 | |
Cty-c | Forward: 5’-GGACAGCCCCGATTTAAGTA-3’ | 57 |
Reverse: 5’-TCAATAGGTTTGAGGCGACAC-3’ | 58 | |
GAPDH | Forward: 5’- AGGTCGGTGTGAACGGATTTG -3’ | 58 |
Reverse: 5’- GGGGTCGTTGATGGCAACA-3’ | 58 |
Figure 5. JPYS improved mitochondrial biogenesis and dynamics in premature ovarian failure (POF) rats. Rats were treated with JPYS (11.0 g/kg.d) and pre-treated with triptorelin (1.5 mg/kg) followed by intraperitoneally injected cyclophosphamide (50 mg/kg). We used real-time qPCR and western blot to detect mitochondrial biogenesis and dynamics. We chose OPA1, Mfn1, and Mfn2 to represent mitochondrial biogenesis function, and PGC-1α to represent the dynamic mitochondrial fusion, and Drp1 and Fis1 to represent mitochondrial fission. The expression of OPA1, Mfn1, Mfn2, PGC-1α, Drp1, and Fis1 in mRNA (A) and protein (B) levels. Data are shown as mean ± SD. *p < 0.05 versus control group, #p < 0.05 versus POF group, △p < 0.05 versus JPYS group. (n=6).