Quiescin-sulfhydryl oxidase inhibits prion formation in vitro

Specific interaction between QSOX and PrP^Sc

To determine whether QSOX and PrP^Sc or QSOX and PrP^C interact, we incubated brain homogenates from sCJD or non-CJD patients with QSOX conjugated to magnetic beads. g5p- and OCD4- conjugated beads were used as positive controls while PDI (protein disulfide isomerase)-conjugated beads were used as a negative control. After elution of the captured PrP from the beads, the samples were treated with or without PK prior to Western blot analysis. Western blotting detected PrP not only in untreated but also in PK-treated samples from sCJD (Fig. 1A). In contrast, no PrP was captured by QSOX-beads from non-CJD in either untreated or PK-treated samples. As expected [17], PrP was also captured by g5p- or OCD4-beads, but not by PDI-beads. These results indicated that QSOX can specifically capture PrP^Sc but not PrP^C. Notably, less than half of the PrP^Sc remained after PK-digestion, suggesting that more than half of the captured PrP^Sc is PK-sensitive PrP^Sc.

Figure 1. Western blotting of PrP captured by QSOX. (A) PrP eluted from the QSOX-conjugated beads was detected by Western blotting with the anti-PrP antibody 3F4. The g5p-beads and OCD4-beads were used as controls while the PDI beads served as a negative control. Like g5p and OCD4, QSOX captures PrP only from CJD but not from non-CJD control brain homogenate. (B) PrP was captured by the QSOX beads from brain homogenates of two sCJD cases (sCJD1 and sCJD2), two cases with different genetic prion diseases (fCJD1 and fCJD2), two cases with VPSPr (Variably protease-sensitive prionopathy) (VPSPr1 and VPSPr2), CWD and hamster 263K. PrP^Sc captured from sCJD2 and fCJD2 was detectable by 3F4 only on the overexposed film (middle panel shows the overexposed part of the above blot containing samples from sCJD2, fCJD1 and fCJD2). The blots were probed with the 3F4 and 6D11 antibodies and they are a representative of three experiments.

Next, different PrP^Sc strains from a variety of animal and human prion diseases were examined. Two sCJD, two familial CJD, two VPSPr (Variably protease- sensitive prionopathy, an atypical human prion disease first identified by our group) [18] (one VPSPr-129MM and one VPSPr-129MV), CWD and hamster 263K were tested. PrP^Sc was captured from all prion-infected brains although the efficiency varied (Fig. 1B). As revealed previously [19], 3F4 mainly detected human and hamster PrP while 6D11 detected not only PrP from the two species but also CWD PrP.

SPR analysis of interaction of various recombinant PrP molecules and QSOX

To further confirm the interaction between QSOX and different PrP forms, we used surface plasmon resonance (SPR) analysis with purified recombinant proteins. QSOX was immobilized on a CM5 sensor surface and different recombinant PrP molecules were used as analytes. Sensorgrams at several concentrations of PrP clearly showed a concentration-dependent binding to immobilized QSOX. We observed that the affinity of QSOX for both full-length MoPrP (23-230) and HuPrP (23-231) was within the nanomolar range (2 nM and 1.7 nM, respectively). In contrast, the truncated constructs MoPrP (89-230) and HuPrP (90-231), containing the folded globular domain of PrP, showed lower affinity, 312 nM and 472 nM, respectively (Fig. 2 and Table 1). When using the unfolded N-terminal region of HuPrP (23-145), the affinity was 3.6 nM, indicating that QSOX has the highest affinity for the N-terminal region of PrP. Although it had low affinity for MoPrP89-230, QSOX exhibited higher affinity for the octamer form than for the monomer form (1.7 nM and 312 nM, respectively), suggesting that there may be conformational binding sites on the octamer.

Figure 2. Sensorgrams of binding kinetics of immobilized QSOX to various PrP proteins. Surface Plasmon Resonance (SPR) was applied as a label-free detection method to determine the binding kinetics of QSOX with various domains of PrPs. The results reveal that the equilibrium constant (KD) is relatively low for the C-terminal globular region of human or mouse PrP (472 or 312 nM) comparing to the unfolded N-terminal region of HuPrP23-145 (3.6 nM). QSOX exhibits a higher affinity for the unstructured N-terminal region than for the C-terminal folded region of PrP, suggesting that the unfolded N-terminal region of PrP is a substrate for QSOX. Interestingly, the octamer form of moPrP89-230 displays high affinity toward QSOX (1.7 nM), indicating that a misfolded form of PrP is a potential substrate for QSOX, in agreement with our in vitro study showing that QSOX binds to PrP^Sc from prion-infected human and animal brains. MoPrP23-230 was injected on immobilized QSOX (A), Octamer (B), MoPrP89-230 (C), HuPrP23-231 (D), HuPrP90-231 (E), HuPrP23-145 (F). Sensorgrams showing the evolution of response (RU, resonance units) using CM5 sensor chip performed in BIAcore 3000 instrument.

Inhibition of PrP^Sc amplification in cell-free protein misfolding cyclic amplification (PMCA) by QSOX

Since QSOX binds PrP^Sc, we hypothesized that QSOX may be able to inhibit PrP^Sc formation in vitro. To test this hypothesis, we investigated the effect of QSOX on PrP^Sc amplification by PMCA. Different amounts of QSOX were added into PMCA reaction. Dose-dependent inhibition of PrP^Sc amplification was observed (Fig. 3).

Figure 3. Effect of QSOX on PrP^Sc amplification by PMCA. (A) Western blotting of PrP in the PMCA products after PrP^Sc amplification by PMCA in the presence of different amounts (0, 70 nM, and 140 nM) of QSOX for a round of PMCA. PrP^Sc was detected by Western blotting with the 3F4 antibody after a round of PMCA. The blot is a representative of three experiments. (B) Quantitative analysis of the amounts of PrP^Sc amplified by PMCA.

Inhibition of PrP^Sc amplification in prion-infected ScN2a cells by QSOX

We next examined the effect of QSOX on PrP^Sc propagation in ScN2a cells. Different amounts of QSOX were added to ScN2a cells and incubated for three days. Cell lysates were collected and treated with PK prior to detection of PK-resistant PrP by Western blotting with the anti-PrP antibody 6D11. PK-resistant PrP decreased with increasing amount of QSOX (Fig. 4), suggesting that QSOX is able to inhibit PrP^Sc propagation in ScN2a cells.

Figure 4. Effect of QSOX on PrP^Sc propagation in ScN2a cells. Western blotting of PrP in ScN2a cells in the presence of different amounts of QSOX ranging from 0 to 50 nM for four days. After four days, the cells were lysed and subjected to PK-digestion at 25 µg/ml prior to SDS-PAGE and Western blotting with 6D11. The intensity of PK-resistant PrP^Sc is significantly decreased at 10 nM of QSOX or greater. β-actin was determined to normalize the levels of individual samples examined. The result shown here is a representative of three experiments.

Materials

Proteinase K (PK) was purchased from Sigma Chemical Co. (St. Louis, MO, USA). Mouse monoclonal antibodies 3F4, which recognizes an epitope of human PrP residues 106-110 (KTNMK) [19,40], and 6D11, which recognizes an epitope of human PrP residues 93-109 (GGTHSQWNKPSKPKTNM), were purchased from Covance (Emeryville, CA, USA). Horseradish peroxidase (HRP)-conjugated sheep anti-mouse or donkey anti-rabbit secondary antibody was purchased from Amersham Pharmacia Biotech, Inc. (Piscataway, NJ, USA). Human brain tissues were collected at autopsy and were kept frozen at the National Prion Disease Pathology Surveillance Center (Cleveland, OH, USA) at -80 ºC until use.

Preparation of recombinant QSOX and protein disulfide isomerase (PDI)

The QSOX over-expression plasmid was a generous gift from Prof. Colin Thorpe. Expression and purification were performed according to the protocol described by Heckler et al [20]. The protein disulfide isomerase (PDI) plasmid was a generous gift from Dr. Joris Messens. Expression and purification were performed as previously described [41].

Expression and purification of various recPrPs

Open reading frames encoding HuPrP(23−231), HuPrP(90−231), MoPrP(23−230), or MoPrP(89−230) were cloned in the pET-28a vector (Novagen) as an Nde1-BamH1 fragment. HuPrP(23−231), HuPrP(90−231), MoPrP(23−230), or MoPrP(89−230) were expressed and purified as soluble proteins according to our previous study [27]. HuPrP(23−144) was refolded from inclusion bodies according to the literature [42,43].

Construction of transgenes expressing human PrP-129V

The transgene constructs are based on the murine half-genomic PrP clone in plasmid pHGPRP [44]. The HuPrP-129V open reading frame (ORF) was amplified from the human genomic DNAPAC (P1-derived artificial chromosome) clone RP5–1068H6 (obtained from the Sanger Center, Cambridge, UK) with primers HRM-F (TATGTGGACTGATGTCGGCCTCTGCAAGAAGCGC) and HRM-R (CCACCTCAATTGAAAGGGCTGCAGGTGGATAC). The PCR product was digested with PshAI and MfeI and used to replace the corresponding 0.97 kb PshAI–MfeI fragment in pHGPRP to create pHGHuPrP-129V. In the resulting pHGHuPrP-129M clones, the signal-peptide sequence is still from mouse, but the rest of the PrP ORF and the first 76 bp after the stop codon are from human PRNP (prion protein) genomic DNA. The inserted 0.97 kb PshAI–MfeI fragment in pHGHuPrP-129V was then sequenced with the primers HRM-R, HRM-F, and HP306R (CATGTTGGTTTTTGGCTTACTC). One error free clone was chosen for the creation of transgenic mice.

Generation, screening, and characterization of transgenic humanized Tg(HuPrP-129V)Prnp0/0 mice

The 12.2 kb HuPrP-129V transgene constructs was microinjected into fertilized FVB/NJ eggs, and planted into the oviducts of pseudopregnant CD-1 mice at the transgenic mouse facility of Case Western Reserve University (Cleveland, OH) as described previously [44]. Founder pups were screened by tail DNA PCR. All founder mice that carry the transgene were bred with FVB/Prnp0/0 mice [45] to obtain Tg mice in PrP-null background. PrP expression in the brain and other tissues of the Tg mice were determined by Western blot analysis using the monoclonal antibody 3F4 against PrP for humanized Tg mice. The Institutional Animal Use and Care Committee and the Institutional Biosafety Committee approved all of the animal experiments in this study, and the use of human brain tissues was authorized by the Institutional Review Board.

Preparation of brain homogenates

Frozen brain tissues from patients with various prion diseases or from animals infected with prions were obtained at autopsy. Consent to use the autopsy brain tissues were obtained for each case. A 10% (w/v) human brain homogenate was prepared in 9 volumes of 1 X lysis buffer (10 mM Tris, 100 mM NaCl, 0.5% Nonidet P-40, 0.5% deoxycholate, 10 mM EDTA, pH 7.4) and was used to provide template PrP^Sc for PMCA. To prepare the substrate for PMCA, brains from humanized transgenic mice described above were perfused with 5% EDTA in PBS and 10% (w/v) brain homogenate from was prepared in 9 volumes of 1 X conversion buffer (0.1% SDS, 0.1% Triton X-100, 1 x PBS, pH 7.0). The supernatant was kept at -80°C for future PMCA use after centrifugation at 1,000 g at 4°C for 10 min.

Protein misfolding cyclic amplification

PMCA was performed as described with slight modifications [44,46]. In brief, 99 µl of brain homogenate from uninfected transgenic mouse brains was incubated with 1 µl of brain homogenate from a case of iatrogenic Creutzfeldt-Jakob disease (iCJD). After addition of designated amounts of recombinant QSOX, all samples were adjusted to equal volumes by the addition of conversion buffer (0.1% SDS, 0.1% Triton X-100, 1 x PBS, pH 7.0). An aliquot was frozen at -80ºC as a control sample without PMCA and the remaining mixture was transferred into a 0.2 ml PCR tube that was placed on a microplate horn filled with water. The sample was subjected to PMCA, consisting of cycles of 30 min incubation at 37ºC followed by a 40 S pulse of sonication at 60% potency for 18 h in a sonicator (Misonix Model 3000, Farmingdale, NY). To detect the amplified PrP^Sc, 20 µl of PMCA-treated or untreated sample was digested with PK, 100 µg/ml, for 70 min at 45°C. The reaction was terminated by adding PMSF to a final concentration of 5 mM and an equal amount of SDS sample buffer, then boiling at 100°C for 10 min. A 10 µl sample was subjected to SDS-PAGE and Western blotting with 3F4.

Scrapie-infected mouse neuroblastoma cell culture (ScN2a)

ScN2a cells seeded in six-well plates (5 X 10⁵ cells/well) containing 3 mL supplemented MEM medium were incubated with the indicated amount of recombinant QSOX for three days. Cell lysates were prepared as described previously [47]. In brief, after removal of the media, cells were rinsed three times with PBS and lysed in 1.2 ml of lysis buffer on ice for 30 min. The cell lysates were centrifuged at 1000Xg for 10 min at 4ºC to remove nuclei and cellular debris. The supernatant was incubated with 5.5 ml pre-chilled methanol at -80ºC for 2 h and centrifuged at 14 000 g for 30 min at 4ºC. The pellet was resuspended in 100 µl lysis buffer. The protein concentration of each sample was measured with Bicinchoninic Acid (BCA) reagent (Bio-Rad, Hercules, CA). Samples of equal amounts and volumes of protein were digested with 50 µg/mL proteinase K for 1 h at 37°C. Digestion was stopped with 2 µM PMSF and an equal volume of sample buffer was added and boiled for 10 min before loading onto 15% SDS-PAGE (SDS-polyacrylamide gel electrophoresis) precast Criterion gel (Bio-Rad, Hercules, CA).

Specific capture of abnormal PrP by QSOX

Recombinant QSOX (100 µg) was conjugated to 7 x 10⁸ tosyl activated magnetic beads in 1 ml of PBS at 37°C for 20 h [48,49]. The QSOX-conjugated beads were incubated with 0.1% BSA in PBS to block non-specific binding. The blocked QSOX beads were stable for at least 3 months at 4°C. Capture of PrP^Sc by QSOX was performed as described [48,49] by incubating S1 fractions and QSOX conjugated beads (10 µg QSOX/6 x 10⁷ beads) in 1 ml of binding buffer (3% Tween-20, 3% NP-40 in PBS, pH 7.5). After incubation with constant rotation overnight at room temperature, the PrP-containing QSOX beads were collected using an external magnetic force and all unbound molecules in the solution were removed by washing. Following three rinses in wash buffer (2% Tween-20 and 2% Nonidet P-40 in PBS, pH 7.5), the QSOX beads were resuspended in SDS sample buffer (3% SDS, 2 mM EDTA, 10% glycerol, 50 mM Tris, pH 6.8) and heated to 95^oC for 5 min to release bound proteins. g5p beads, OCD4 beads, and beads conjugated with protein disulfide isomerase (PDI) were used as controls.

Surface plasmon resonance (SPR)

Binding kinetics were determined using a Biacore 3000 (GE Health care). 2 µg QSOX was diluted in 10 mM sodium acetate, pH 5.2 and immobilized on a CM5 chip activated with EDC/NHS using a flow rate of 5 µl/min. After immobilization and blocking with ethanolamine a steady signal of 1000 RU was obtained. All kinetic analyses were run at 30 µl/min flow rate in PBS, 0.05% Tween 20, 3mM EDTA at 25°C. After each cycle, the surface was regenerated by a 60s pulse of 100 mM glycine, pH 1.5. Association rates (K_on) and dissociation rates (K_off) were obtained using a 1:1 Langmuir binding model (Biacore evaluation software version 4.1). The equilibrium dissociation constant (K_d) was calculated from the ratio K_off/K_on.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting

Samples were mixed with an equal volume of 2 X SDS sample buffer and boiled for 10 min. Proteins were separated using 15% Tris-HCl pre-cast gels (Bio-Rad). Electrotransfer of the proteins from the gel to the polyvinylidene difluoride (PVDF) membranes was performed at 70 V for 2 h. The membranes were blocked with 5% non-fat milk in TBS-T buffer overnight at 4°C or 1 h at 37°C prior to incubation with antibodies. Membrane-bound proteins were probed with 6D11 at 1:6,000, 3F4 at 1:40,000, or anti-β-actin antibody at 1:6,000. The blot was then incubated with HRP-conjugated donkey anti-rabbit or sheep anti-mouse antibody at 1:6,000. The PrP bands were visualized by enhanced chemiluminescence (ECL Plus, Amersham Pharmacia Biotech, Inc., Piscataway, NJ, USA).

Statistical Analysis

Statistical significance of differences in PrP intensity was evaluated using Student’s t-test. A difference was considered statistically significant if p value was < 0.05.