Long noncoding RNA TPT1-AS1 promotes the progression and metastasis of colorectal cancer by upregulating the TPT1-mediated FAK and JAK-STAT3 signalling pathways

TPT1-AS1 is elevated in CRC tissues and its upregualtion predicts poor survival of CRC patients

Firstly, we examined TPT1-AS1 expression in 72 CRC and 36 adjacent normal tissues by qRT-PCR method. The result showed that TPT1-AS1 was upregulated in CRC tissues (Figure 1A). Moreover, The level of TPT1-AS1 in metastasis CRC tissues was significantly higher than nonmetastatic tumor tissues (Figure 1B). Base on the median value of TPT1-AS1 expression in tumor tissues, the CRC patients were assigned high expression group (n=42) and low expression group (n=30) (Figure 1C). The correlation of TPT1-AS1 expression and CRC clinical pathologic features were investigated by χ² tests. As shown in Table 1, TPT1-AS1 expression was significantly correlated with tumor invasion depth (P=0.038), TNM stage (P=0.025) and distant metastasis (P=0.031). Additionally, the high TPT1-AS1 expression in CRC patients was implied the poor overall survival (Figure 1D). Besides, our result was consistent with the GEO data (GSE95423) which demonstrated TPT1-AS1 upregulation in CRC tissue with liver mmetastasis comparing to CRC tissue without metastasis (Figure 1E).

Figure 1. TPT1-AS1 is elevated in CRC tissues and its upregualtion predicts poor survival of CRC patients. (A) qRT-PCR detected TPT1-AS1 expression in 72 CRC and 36 adjacent normal tissues; (B) Expression of TPT1-AS1 was detected in metastatic CRC (CRC-M) and nonmetastatic tumor tissues (CRC-NM); (C) TPT1-AS1 expression in CRC patients was divided into high expression and low expression groups according to the median value; (D) The overall survival of CRC patients was evaluated by Kaplan-Meier analysis; (E) TPT1-AS1 expression was analyzed in metastatic CRC (CRC-M) and nonmetastatic tumor tissues from GEO data (GSE95423). *P<0.05.

TPT1-AS1 promotes CRC cell proliferation, migration and invasion in vitro and in vivo

To explore the role of TPT1-AS1 in CRC cells, the endogenous expression of this transcript in CRC cell lines (HCT116, HT-29, SW620 and LoVo) and a normal colonic cell line (NCM460) was detected by qRT-PCR. The result showed that the level of TPT1-AS1 was significantly elevated in the tumour cell lines, particularly HCT116 and LoVo cells, compared to that in the NCM460 cells (Figure 2A). Subsequently, TPT1-AS1 was knocked down in the HCT116 and LoVo cells and enhanced in the SW620 cells, and the levels were confirmed by qRT-PCR assay (Figure 2B, 2C, respectively). MTT and clone formation assays showed that TPT1-AS1 knockdown suppressed cell proliferation and growth, whereas TPT1-AS1 overexpression demonstrated promoting effects (Figure 2D, 2E). Importantly, the silencing of TPT1-AS1 significantly reduced tumour volume and weight (Figure 2F). This difference was further confirmed following the examination of the xenograft by H&E, the tumours that developed from TPT1-AS1-depleted cells displayed lower Ki-67 staining than those in the control group (Supplementary Figure 1). These results indicated that TPT1-AS1 exerted a significant promotive effect on the tumorigenesis of CRC in vitro and in vivo.

Figure 2. TPT1-AS1 promotes CRC cell proliferation in vitro and vivo. (A) TPT1-AS1 endogenous level in CRC cell lines and normal colonic cell line NCM460 was detected by qRT-PCR. TPT1-AS1 expression was examined in TPT1-AS1 silencing HCT116 and LoVo cells (B) and overexpressing SW620cells (C). MTT (D) and clone formation assays (E) were applied to assess the effect of TPT1-AS1 on CRC cell proliferation and growth. (F) TPT1-AS1 knockdown inhibited the tumor volume and weight in nude mice tumorigenicity assay. *P<0.05, **P<0.01.

As shown in Figure 3A, TPT1-AS1 knockdown significantly enhanced the cell adhesion ability, whereas TPT1-AS1 overexpression had the opposite effect. The migration and invasion assays demonstrated that TPT1-AS1 depletion significantly impaired cell migration and invasion, but the opposite was observed when TPT1-AS1 was overexpressed in the SW620 cells (Figure 3B, 3C). Furthermore, we investigated the effect of TPT1-AS1 on liver metastasis in vivo. As shown in Figure 3D–3F, the TPT1-AS1 knockdown group displayed a reduction in the number of metastatic modules in the liver when compared to the control group, indicating that TPT1-AS1 could promote cell migration and metastasis in vitro and in vivo.

Figure 3. TPT1-AS1 promotes CRC cell migration and invasion in vitro and vivo. (A) Cell adhesion assay was applied to determine the effect of TPT1-AS1 on CRC cell adhesion (magnification 200x). Wound scratch (magnification 100x) (B) and Transwell assays (magnification 200x) (C) were performed to examine the effect of TPT1-AS1 on CRC cell invasion and migration. (D) TPT1-AS1 knockdown suppressed CRC liver metastasis in vivo, the gross specimen images of liver metastases. (E) The metastatic nodules in liver tissue were detected by HE staining (magnification 100x). (F) The statistical analysis of number of liver metastatic nodules. *P<0.05, **P <0.01.

TPT1-AS1 upregulated the expression of TPT1 by H3K4 me3 modification

Subcellular fractionation analysis showed that TPT1-AS1 was mainly enriched in the nucleus of the HCT116, LoVo and SW620 cells (Figure 4A). The FISH analysis confirmed a similar subcellular localisation of TPT1-AS1 in the tissues (Figure 4B); moreover, the percentage of positive signals in the CRC tissues was higher than that in the adjacent tissues. Antisense lncRNA tends to modulate the expression of its sense mRNA; therefore, we speculated that TPT1-AS1 may regulate the level of TPT1 in CRC. Firstly, the expression level of TPT1 was elevated in the CRC specimens as detected by qRT-PCR, which was consistent with the expression level of TPT1-AS1 in CRC samples (Figure 4C). Additionally, a positive correlation between TPT1 and TPT1-AS1 expression levels were observed in the CRC tissues (Figure 4D). Similarly, the result of the Western blot analysis showed that the expression level of TPT1 was significantly increased in the CRC specimens when compared to that in the adjacent normal tissues (Figure 4E). Furthermore, the mRNA and protein expression levels of TPT1 were significantly reduced in the TPT1-AS1-silenced cells and increased in the cells that overexpressed TPT1-AS1 (Figure 4F). These findings suggested that TPT1-AS1 could upregulate TPT1 expression.

Figure 4. TPT1-AS1 upregulated the expression of TPT1 by H3K4me3 modification. (A) Subcellular fractionation analysis showed that TPT1-AS1was mainly enriched in the nucleus of CRC cells. (B) FISH analysis the subcellular localization of TPT1-AS1 in tissues (magnification 100x). (C) qRT-PCR detected TPT1 expression in 72 CRC and 36 adjacent normal tissues. (D) The correlation between TPT1-AS1 and TPT1 expression was analyzed in 72 CRC tissues. (E) Western blot showed that our CRC specimen had a obviously increased TPT1 level compared with adjacent normal tissues. (F) TPT1 mRNA (upper)and protein (down) level were examined in TPT1-AS1 overexpression and knockdown cells. (G) ChIP assay showed that TPT1-AS1 depletion reduced the H3K4me3 modification in TPT1 transcription region. (H) ChIP analysis reveals that MLL1 mediated TPT1-AS1 regulation TPT1 transcription. (I) ChIP analysis demonstrated that H3K4me3 level was reduced in the TPT1 promoter region after MLL1 depletion. (J) RIP assays confirmed that TPT1-AS1 could physically bind to MLL1. (K) TPT1 expression was impeded when MLL1 was silenced by siRNA. 1,3 stand for Lv-con group; 2,4 stand for Lv-sh-TPT1-AS1 group; 5 stand for vector group; 6 stand for TPT1 overexpression group. *P<0.05.

To further investigate the potential mechanism of TPT1-AS1 in upregulating the expression of TPT1 in CRC, we analysed the extent of histone modification in the ENCODE data. The activated histone modification H3K4 m3 was enriched around the TPT1 promoter region (Supplementary Figure 2). Whether TPT1-AS1 could recruit methyltransferase MLL1, the charge of H3K4 trimethylation modification. RNA-Protein Interaction Prediction analysis displayed an interaction between TPT1-AS1 and MLL1 (Supplementary Figure 3). The ChIP assay was applied to verify the interacting by using the anti-H3K4 me3 and MLL1 antibodies. As shown in Figure 4G, the amplification of the TPT1 promoter fragment (TPT1-pro) was reduced in the precipitates of the TPT1-AS1-silenced cells, implying that TPT1-AS1 mediated the H3K4 me3 modification in the TPT1 transcription region. The ChIP assay using the MLL1 antibody displayed a similar reduction in TPT1-pro (Figure 4H), indicating that MLL1 participated in TPT1-AS1 regulation TPT1 transcription. In addition, it demonstrated that the level of H3K4 me3 was reduced in the TPT1 promoter region after MLL1 depletion (Figure 4I). The RIP assays confirmed that TPT1-AS1 could physically bind to MLL1 (Figure 4J). TPT1 expression was impeded following the knockdown of MLL1 by siRNA (Figure 4K). Taken together, these results indicated that TPT1-AS1 recruited MLL1 to the promoter region of TPT1 and enhanced the H3K4 me3 level, resulting in the upregulation of TPT1.

TPT1-AS1 promotes CRC progression via TPT1

To evaluate the role of TPT1 on the TPT1-AS1-mediated increase in cell proliferation, migration and invasion in the CRC cells, rescue experiments were performed. The expression level of TPT1 was elevated in the TPT1-AS1-silenced cells by transfecting them with a pcDNA3.1-TPT1 plasmid and verified by qRT-PCR (Figure 5A). As shown in the functional experiments, the ectopic expression of TPT1 significantly reduced the suppressive effects on cell proliferation, migration and invasion and attenuated the promotive effects on cell adhesion mediated by TPT1-AS1 knockdown (Figure 5B–5F).

Figure 5. TPT1-AS1 promotes CRC progression via TPT1. (A) TPT1 expression was restored in TPT1-AS1 depletion cells via transfecting the pcDNA3.1-TPT1 plasmid. MTT (B) and clone formation assays (C) showed that ectopic expression of TPT1 could remarkably relieved the suppressive effects on cell viability and proliferation causing by TPT1-AS1 knockdown. (D) Restoring TPT1 expression could obviously attenuated the promotive effects on cell adhesion inducing by TPT1-AS1 depletion (magnification 200x). Wound scratch (magnification 100x) (E) and Transwell assays (magnification 200x) (F) showed that ectopic expression of TPT1 could obviously relieved the suppressive effects on cell migration and invasion causing by TPT1-AS1 knockdown. *P<0.05.

TPT1-AS1 promoted CRC progression via TPT1/FAK/JAK-STAT3 signalling

To investigate the underlying mechanisms of TPT1-AS1/TPT1 in CRC progression, we performed the GSEA analysis using the TCGA CRC datasets and found that TPT1 expression was positively correlated with FA and JAK-STAT3 signalling (Supplementary Figure 4). Interestingly, the positive correlation between TPT1- AS1 and FAK, JAK1, JAK2 and STAT3 expression levels were observed in the CRC tissues (Supplementary Figure 5). Western blot detection showed that the expression levels of p-FAK, p-JAK1, p-JAK2 and p-STAT3 were significantly reduced following TPT1-AS1 knockdown in the HCT116 and LoVo cells; however, this decrease was effectively mitigated when TPT1 was ectopically overexpressed. Alternatively, the levels of p-FAK, p-JAK1, p-JAK2 and p-STAT3 were increased in the TPT1-AS1-overexpressed SW620 cells (Figure 6A). Importantly, this increase was effectively attenuated when the cells were treated with the FAK inhibitor (PF573228). Furthermore, the FAK inhibitor significantly attenuated the promotional effects on cell proliferation, migration and invasion and enhanced the adhesion ability in the TPT1-AS1-overexpressed SW620 cells (Figure 6B–6F). These results indicated that TPT1-AS1 promoted CRC progression via the TPT1/FAK/JAK-STAT3 signalling pathway (Figure 7).

Figure 6. TPT1-AS1 promoted CRC progression via the TPT1/FAK/JAK-STAT3 signaling. (A) Western blot was conducted to examine p-FAK, FAK, p-JAK1, JAK1, p-JAK2, JAK2, p-STAT3 and STAT3 expression in TPT1-AS1 knockdown and overexpression cells. FAK inhibitor (PF573228) could remarkably attenuated the promotional effects on cell viability (B), colony formation (C), migration (magnification 100x) (D) and invasion (magnification 200x) (E), and inhibited adhesion ability (magnification 200x) (F) in TPT1-AS1-overexpressing SW620 cells. 1 stand for Lv-con group; 2 stand for Lv-sh-TPT1-AS1 group; 3 stand for Lv-sh-TPT1-AS1+TPT1 group; 4 stand for vector group; 5 stand for TPT1 overexpression group; 6 stand for TPT1+ FAK inhibitor group. *P<0.05, **P<0.01.

Figure 7. A proposed model for illustrating the function and mechanism of TPT1-AS1 in CRC growth and metastasis.

Clinical specimens

A total of 72 CRC tissues and 36 adjacent tissues were enrolled from the second Xiangya Hospital, Central South University, from March 2012 to April 2016. No patient was administered to preoperative chemotherapy and radiotherapy. The fresh tissues were fast frozen in liquid nitrogen and kept at -80° C. All of the patients were followed-up regularly intervals after surgery. This study was approved by the Ethics Committee of the Second Xiangya Hospital of Central South University and informed consent have signed by all patients. The pathological features were acquired from patients’ medical records.

Cell culture and transfection

The CRC cell lines (HCT116, LoVo, SW620 and HT-29) and normal colonic epithelial cell line NCM460 were purchased from American Typer Culture Collection (ATCC) and cultured according to the instructions.

TPT1-AS1 siRNAs specially targeting TPT1-AS1 were designed and synthesized by GenePharma (Shanghai, China). The most interference effectiveness of target sequence was chosen to be packaged lentiviruses by GenePharma (Shanghai, China). A scrambled was used as negative control. To construct TPT1-AS1 downregulated cells model, HCT116 or LoVo (1×10⁵ cells) were mixed with polybrene (5 μg/ml), and Lv-sh-TPT1-AS1(4×10⁸ TU/ml, 5 μL), or Lv-con(2×10⁸ TU/ml, 10 μL). 48 hours later, transfected cells were selected by 20 μg/ml puromycin (Thermo Fisher, USA).

For overexpressional plasmids construction, the TPT1-AS1 sequence and TPT1 cDNA ORF were synthesized and subcloned into the pcDNA3.1 vector (General Biosystems, Chuzhou, China). Plasmids were transfected into cells using Lipofectamine 2000 (Thermo Fisher, USA) following the manufacturers’ instructions. Cells were harvested at 48 h after transfection.

qRT-PCR

Total RNAs were isolated with Trizol (Thermo Fisher, USA). cDNA was reversely transcribed with RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher, USA) following the instructions. qRT-PCR was conducted with SYBR Green I (TOYOBO, Japan) and detected by 7500 Real-Time PCR System (ABI, USA). Internal control was chosen β-actin gene for normalizing. qRT-PCR primers sequences were listed as following: TPT1-AS1 forward: 5’- GGTCAGCTCCAAGGAGGCTAT-3’, TPT1-AS1 reverse: 5’- GCCAGTGCTCTGAAGGAAAAC’; TPT1 forward: 5’- CGAGTTTCAGGCTCGTGCTA -3’, TPT1 reverse: 5’-TTCCTTCCTGGGCATGGAGTC-3’; β-actin forward: 5’-TGGCATCCACGAAACTACCT-3’, β-actin reverse: 5’-TCTTCATTGTGCTGGGTGCC-3’.

MTT and Clone formation assays

Cell viability and proliferation were examined by MTT and clone formation assays respectively. For MTT detection, each group cells (1×10⁴ cells/well) were seeded into 96-well plates. 24 h later, each well was added 20 μl MTT and incubated at 37° C for 4 h. After removing the culture, each well was supplemented 150 μl of DMSO and incubated at 37° C for 10 min. Subsequently, the absorbance was detected at 570 nm by the microplate reader Thermo K3 (Thermo Scientific, USA). For clone formation experiment, 1×10³ cells were plated into a 35 mm dish and cultured for nearly two weeks. Then, colonies of cells were fixed in 4% paraformaldehyde (PFA) and stained with 0.01% crystal violet dye.

Cell adhesion analysis

Cells (5×10⁴ cells/well) were seeded in 24-well plate coated with 1:5 diluted Matrigel (Corning, USA), and incubated at 37° C for 30 min. Then removing the culture and non- adhered cells, the adhered cells were rinsed by PBS twice times and fixed in 4% PFA for 30 minutes. Subsequently, cells were stained with 0.1% crystal violet for 20 minutes at room temperature.

Cell migration and invasion analysis

Wound scratch was applied to examine cell migration. Simply, cells were plated in the 12-well plates and grown to 100% confluence. Cell wounds were scratched using a 20 μl pipette tube. Wound closure was measured the distance between the opposite edges of the wound after 0 and 24 h. BioCoat Matrigel Invasion chamber (Corning, USA) was applied to invasion assay. 1×10⁵ cells suspended in serum-free medium were plated into the upper chambers (coated with matrigel), while the lower chambers were added medium containing 10% FBS. Incubating at 37° C for 48 h, the translocated cells were fixed with 4% PFA and stained by 0.1% crystal violet for 20 min. Subsequently, the invasive cells were photographed and counted under the microscope.

Western blotting

RIPA buffer containing protease and phosphatase inhibitors was used to lyse cells on ice for 0.5 h using. Proteins were extracted from supernatant of cell lysate and quantified the concentration by BCA Kit (Thermo Fisher, USA). 30 μg proteins per sample were separated by 10% SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF) membrane (Thermo Fisher, USA). The membrane were blocked by 5% non-fat dry milk, and then added primary antibodies against TPT1 (1:1000, Abcam), p-FAK (Try397) (1:1000, CST), FAK (1:1000, CST), p-JAK1(1:1000, Abcam), p-JAK1 (1:1000, Abcam), p-JAK2 (1:1000, CST), JAK2 (1:1000, CST), p-STAT3 (1:1000, CST), STAT3 (1:1000, CST), overnight at 4° C, followed by incubating with HRP-labeled secondary antibody. The blotting signal was examined by using enhanced chemiluminescence reagent (Thermo Fisher, USA). β-actin used as control.

Subcellular fractionation

The nuclear and cytosolic fractions of LoVo and SW620 cells were separated with PARIS Kit (Thermo Fisher, USA) following the manufacturers’ instructions.

Fluorescence in situ hybridization (FISH)

The probe of TPT1-AS1 was designed and synthesized by BersinBio (Guangzhou, China), and its sequence was 5’-TTGGAGCTGACCTGAAGTGAAGATCTGGGAGTGG-3’ and labeled with CY3. FISH was conducted according to previously described methods [27]. Fresh tissue samples were fixed with 4% PFA for 48 h and dehydrated using graded ethanol. After vitrification by dimethylbenzene and embedding in paraffin, the tissues were subjected to dewaxing and hydration. After denatured at 73° C for 3 min, the sections were covered with hybridization solution that containing 5 ng/μl probes. Hybridization was placed in a moist chamber at 42° C overnight. Then the sections were rinsed with 4× Saline Sodium Citrate (SSC) containing 1% Tween-20, descending series of SSC for 5 min at 42° C. Subsequently, the nucleus was stained by DAPI. The sections were observed and photographed by fluorescent microscopy (Nikon, Japan).

Chromatin Immunoprecipitation (ChIP)

ChIP experiment was conducted by the EZ-Magna ChIP kit (Millipore, USA) and carried out as previous described [27]. Cells were fixed in 4% PFA and quenched with glycine for 10 min. DNA was broken into 200 to 600 bps through ultrasonication. The lysates were immunoprecipitated with anti-H3K4me3 antibody (ab213224, Abcam, USA) or anti-MLL1 (NB600-256, Novus, USA) or rabbit IgG. The ChIP product was analyzed by PCR. Primers used in ChIP assay were presented as following: TPT1-pro forward: 5’-AGCGGCTGAGTCGGCCTTTTC-3’, TPT1-pro reverse: 5’-TGTGCGGCAGTAAGGATAGTG-3’.

RNA immunoprecipitation (RIP) assay

RIP was conducted by EZ-Magna RIP kit (Millipore, USA) and performed as previous study [27]. Simply, cells were crosslinked with 1% formaldehyde and lysed in RIPA buffer containing proteinase and RNase inhibitor. Then the magnetic beads pre-conjugated with anti-MLL1 antibody (NB600-256, Novus, USA) or IgG were incubated with the cell lysate at 4° C overnight. RNA was purified from immunoprecipitataion complex and RT-PCR was applied to assess the expression of TPT1-AS1. Primers were presented as following: TPT1-AS1 forward: 5’-GAGACACAAGGCTCCGTTCC-3’, TPT1-AS1 reverse: 5’- AACAGCCAGGTTTTGAGAGC-3’.

Gene set enrichment analysis (GSEA)

The GSEA was launched to analyze gene sets correlated with TPT1 in CRC. Gene expression data of CRC were downloaded from TCGA database. TPT1 expression was set high and low categories base on the median expression value. The TPT1 correlated gene sets and pathways were explored in the c2.cp.kegg.v7.0.symbols.gmt data set by GSEA v3 soft. P <0.05 and false discovery rate (FDR) <0.25 was the criterion for identifying statistically enriched genes.

In vivo tumorigenic and metastasis assays

4-week-old male BALB/c nude mice were fed according to the guidelines authorized by the Animal Care Committee of the second Xiangya Hospital, Central South University.

For vivo tumorigenicity, animals were randomly divided into two groups (n=5 for each group) and transplanted subcutaneously with 1×10⁷ HCT116-Lv-sh-TPT1-AS1 or HCT116-Lv-con at the right flank. Tumor growth was measured and recorded every 5 days. 25 days later, animals were killed after anesthetized and stripped the tumors. Tumor volume was calculated by the formula: (length × width²)/2. The tumors tissues were paraffin-embedded, formal infixed and performed H&E staining, immunostaining analysis for Ki-67 protein expression.

For metastasis assay, Lv-sh-TPT1-AS1 or control Lv-sh-con lentivirus infected HCT116 cells (5×10⁶/ 0.2 ml PBS) were intrasplenic injected into each mouse (n=6 for each group). 8 weeks later, animals were killed after anesthetized and liver tissues were surgically excised. The the liver tissues were fixed in formalin and embedded in paraffin for hematoxylin and eosin (HE) examination. Metastatic nodules were analyzed under microscopy.

Statistical analysis

Each assay was performed at least three times, the data were presented as mean ± standard deviation (SD). The statistical analysis was conducted by SPSS 20.0 software (SPSS Inc., IL, USA). Student’s t-test was applied to analyze the differential expression between two groups. The χ² test was applied to assess the relationship between TPT1-AS1 expression and clinicopathological features of CRC. Survival was estimated by the Kaplan-Meier method. P < 0.05 were identified statistically significant.